| Gene Name | Classification | Accession number | Forward Primer | Reverse Primer | Notes | Source | |
| CD69 (Activation inducer molecule) (AIM) | Activation/Mitogenic | AF272828 | CGTTGCTCTATCAGTGGGCC | CCCCTTGTGTCCAATCCAATC | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| C-myc | Activation/Mitogenic | AF519455 | GATGCCACGTGTCTACCCATC | GACCCTGCCACTGTCCAACT | Induced upon activation | Lord, J.D., McIntosh, B.C., Greenberg, P.D., Nelson, B.H. The IL-2 receptor promotes lymphocyte proliferation and induction of the c-myc, bcl-2, and bcl-x genes through the trans-activation domain of Stat5. J. Immunol. (2000) 164: 2533-2541. | |
| Early growth response 1 (EGR1) | Activation/Mitogenic | XM_601394 | CAGTGGGAACACCTTGTGGC | CGGGAGATGATGCTGAAGATG | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Early growth response 2 (EGR2) | Activation/Mitogenic | XM_593103 | GTGTCGGATCTGTATGCGCA | GGCCACAGTAATCACAGGCAA | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Early growth response 3 (EGR3) | Activation/Mitogenic | XM_604596 | CTTCCAGTGCAGGATCTGCA | AGAACTCGCAGGCAAAGGG | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Immediate early response 3 (IER3) | Activation/Mitogenic | NM_001075202 | TCAGCTGCCAGTCGAGGAA | CAGACGCACTGTCTTCAGCC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Interleukin 2 receptor a (IL2Ra) (CD25) | Activation/Mitogenic | NM_174358 | TACCTGGCTGCGTGACAGAG | GCAGTTTATCATGGTGCCCAC | Induced upon activation | Ferens, W.A., Davis, W.C., Hamilton, M.J., Park, Y.H., Deobald, C.F., Fox, L., Bohach, G. Activation of bovine lymphocyte subpopulations by staphylococcal enterotoxin C. Infect. Immun. (1998) 66: 573-580. | |
| Mitogen-induced nuclear orphan receptor (MINOR) | Activation/Mitogenic | XM_607313 | CCTACGTTCCCACCTCACCA | GTGCACGCAGGGCATATTC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| NF-Atc (nuclear factor of activated T-cells) | Activation/Mitogenic | XM_588519 | TCGGAGGGAAGAGGATGGTC | CATCTCCCAGATGTGGTGCC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| ODC (ornathine decarboxylase) | Activation/Mitogenic | XM_593582 | CTTTTGGAACGGGCGAAAG | GAGATGGCCTGCACAAAGGT | Induced upon activation, higher in CD8- gd T cells | Fidelus, R.K., Laughter, A.H., Twomey, J.J. The role of mitogens and lymphokines in the induction of ornithine decarboxylase (ODC) in T lymphocytes. J. Immunol. (1984) 132: 1462-1465. | |
| Phosphoprotein regulated by mitogenic pathways | Activation/Mitogenic | XM_600128 | GCTGCAAGGTGTTTCCCATT | AAGGATCACCTCCACGATGC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Pre-B-cell colony-enhancing factor 1 homolog (PBEF) | Activation/Mitogenic | XM_878509 | GCCCGAGATGAATGCTGC | TGCTTGTGTTGGGTGGGTACT | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Regulator of G-protein signaling 16 (RGS16) | Activation/Mitogenic | NM_174450 | TTCAGCGAGGAGAACCTGGA | TCCTCAAAGATCCGGTGAGC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| CD11a (integrin alpha L) | Adhesion molecule | NM_198221 | AGTTGTGTGGCGTTGACGTG | GATAAACACCCGGCCTCCTC | Induced upon activation | Brandes, M., Willimann, K., Moser, B. Professional antigen-presentation function by human gammadelta T cells. Science. (2005) 309:264-268. | |
| CD11c (integrin alpha X) | Adhesion molecule | XM_599270 | ACCTCCAGCCTATGTTGGCA | GAGGTCATCCTGGCAGACGT | Induced upon activation | Brandes, M., Willimann, K., Moser, B. Professional antigen-presentation function by human gammadelta T cells. Science. (2005) 309:264-268. | |
| CD18 (integrin beta 2) | Adhesion molecule | NM_175781 | TGCTGGTCATCTGGAAGGC | AGGGTTATCGTTGTTCCACTGG | Induced upon activation | Brandes, M., Willimann, K., Moser, B. Professional antigen-presentation function by human gammadelta T cells. Science. (2005) 309:264-268. | |
| CD44 | Adhesion molecule | NM_174013 | CAATTCCATCTGTGCTGCGA | GGTGGAGCTGAGGCATTGAA | Induced upon activation, higher in CD8- gd T cells | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| CD54 (ICAM1 intercellular adhesion molecule 1) | Adhesion molecule | NM_174348 | TCGATCGACCCTCACCTTG | TTAGCGTCTGAGGCTGGGA | Induced upon activation | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| CD56 (NCAM1) | Adhesion molecule | BT020673 | CTGGAGAACATCCACCCGAA | TCTTCAGCGTCAGGGACGAC | Induced upon activation | Satoh, M., Seki, S., Hashimoto, W., Ogasawara, K., Kobayashi, T., Kumagai, K., Matsuno, S., Takeda, K. Cytotoxic gammadelta or alphabeta T cells with a natural killer cell marker, CD56, induced from human peripheral blood lymphocytes by a combination of IL-12 and IL-2. J. Immunol. (1996) 157: 3886-3892. | |
| Integrin alpha 6 | Adhesion molecule | XM_867840 | GCTGTGGCTGCTTTACCTGTC | AGTCCCCAGTTTTCTCGATCAC | Higher in CD8+ gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| Integrin alpha X (antigen CD11C) | Adhesion molecule | XM_599270 | ACCTCCAGCCTATGTTGGCA | GAGGTCATCCTGGCAGACGT | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Integrin beta 7 | Adhesion molecule | XM_591814 | AGTCGCAGCCCAGAGTTTGA | AGTGTGGCACTGGTGACAGC | Higher in CD8+ gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| L-selectin | Adhesion molecule | NM_174182 | GGGTACTACGGGCCTGAGTG | CTGAAGTTCCCCAAAGGGTG | Repressed upon activation | Sanchez-Garcia, J., Atkins, C., Pasvol, G., Wilkinson, R.J., Colston, M.J. Antigen-driven shedding of L-selectin from human gamma delta T cells. Immunology. (1996) 89: 213-219. | |
| Thrombospondin 3 | Adhesion molecule | XM_882152 | CCACAGTGCAGTGACCAACG | GCAGTTCCACCAGGATCTGG | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Annexin A1 (Phospholipase A2 inhibitory protein) | Antiapoptotic | XM_589365 | CGTCAGCAGATCAAAGCGG | GCCAAAACAACTTCCTCAAGGT | Repressed upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| Annexin V | Antiapoptotic | NM_001040477 | CGGATGAGGAGAGCATCCTG | CAGAAGGTCCCTGCCAAACA | Higher in CD8+ gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| BCL2-related protein A1 | Antiapoptotic | NM_001037100 | GCAGATACAGCAACCTGGATCC | ACTGCTTCAGAGTCCTTTCCACTT | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| BCL-XL (BCL2-like 1) | Antiapoptotic | NM_001077486 | ATCACCCCAGGGACAGCATA | CCGAAGGAGAAAAAGGCCAC | Higher in CD8- gd T cells | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| Calpactin I heavy chain (annexin A2) | Antiapoptotic | NM_174716 | GACCAACCGCAGCAATGAA | GGCCAGACAAGGCTGACTTC | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| CD40 (TNF receptor superfamily member 5) | Antiapoptotic | XM_581509 | GCACAGATACTGCAACCCCA | TGGTACAGTGTTGGCCTTCG | Induced upon activation | Brandes, M., Willimann, K., Moser, B. Professional antigen-presentation function by human gammadelta T cells. Science. (2005) 309:264-268. | |
| IAP3 (Inhibitor of apoptosis protein 3) (BIRC4) | Antiapoptotic | XM_583068 | GTCCTGTTTCAGCATCAACGC | GCCATCTATCTACTGCTGCATGAC | Repressed upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| Mucosa-associated-lymphoid-tissue lymphoma-translocating gene 1 (MALT1) | Antiapoptotic | XM_581210 | CCAAAGGCAAGCAGGCTCTA | CACCAGAGACTCCGCAGAATG | Induced upon activation | Budd, RC, Yeh, W-C, and Tschopp, J. cFLIP regulation of lymphocyte activation and development. Nature Reviews Immunology. (2006) 6:196-204. | |
| Peroxiredoxin 2 | Antiapoptotic | NM_174763 | CCCCTGCTGGCTGATGTAAC | TTGCCGTCGATGACAAAGAG | Higher in CD8- gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| Pim-1 | Antiapoptotic | NM_174144 | TTCGGCTCGGTGTACTCAGG | TTAGGCAGCTCTCCCCAGTC | Induced upon activation | Wingett, D., Stone, D., Davis, W.C., Magnuson, N.S. Expression of the pim-1 protooncogene: differential inducibility between alpha/beta- and gamma/delta-T cells and B cells. Cell Immunol. (1995) 162: 123-130. | |
| SOD1 | Antiapoptotic | NM_174615 | GGCTGTACCAGTGCAGGTCC | GCTGTCACATTGCCCAGGT | Higher in CD8+ gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| Beta 2-microglobulin | Antigen presentation/recognition | NM_173893 | CTTGGTCCTTCTCGGGCTG | GCTTTCCATCTTCTGGTGGGT | Identified by SAGE | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| Calreticulin (Calregulin) | Antigen presentation/recognition | NM_174000 | CGTTCTCAGTTCCGGCAAGT | GCTCAAATCTGGCCGACAGA | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| CD1a | Antigen presentation/recognition | NM_001075382 | GCCCTGGACAACTGACGCT | CTGAGTGCCCTGTTGCTCCT | Induced upon activation | Morita, C.T., Beckman, E.M., Bukowski, J.F., Tanaka, Y., Band, H., Bloom, B.R., Golan, D.E., Brenner, M.B. Direct presentation of nonpeptide prenyl pyrophosphate antigens to human gamma delta T cells. Immunity. (1995) 3: 495-507. | |
| CD1d | Antigen presentation/recognition | XM_594177 | GCTGCAGCCCTATACTTGGC | TTCAGGAAGCCGATGGTGTT | Induced upon activation | Yamashita, S., Tanaka, Y., Tsutsumi, S., Aburatani, H., Minato, N., Ihara, S. Analysis of mechanism for human gammadelta T cfell recognition of nonpeptide antigens. Biochem. Biophys. Res. Commun. (2005) 334: 349-360. | |
| CD3 delta chain (TiT3 complex) | Antigen presentation/recognition | NM_001034033 | GGCCCTGGAGAATCACTCCT | GGTAGCCACAAGTCCACATGG | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| CD80 | Antigen presentation/recognition | XM_617543 | TGCAGGTGTGGCCTGAATAC | GTAGGTGCCACTGTCCGACA | Induced upon activation | Brandes, M., Willimann, K., Moser, B. Professional antigen-presentation function by human gammadelta T cells. Science. (2005) 309:264-268. | |
| CD86 | Antigen presentation/recognition | NM_001038017 | TCAGGTGCTGCTTCCTTGAA | ACCAGTTCGTCCAGGCTGAG | Induced upon activation | Brandes, M., Willimann, K., Moser, B. Professional antigen-presentation function by human gammadelta T cells. Science. (2005) 309:264-268. | |
| cIIta | Antigen presentation/recognition | XM_585540 | GAGGAGGCAGGGCAGAAAAG | CTCAACAAGGAACTGGACGGA | Induced upon activation | Drozina, G., Kohoutek, J., Jabrane-Ferrat, N., Peterlin, B.M. Expression of MHC II genes. Curr. Top. Microbiol. Immunol. (2005) 290: 147-170. | |
| MHC class I | Antigen presentation/recognition | XM_872941 | AATCAGCTCGCCTATGACGG | CACTTGCGCTTGGTGATCTG | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| MHC class II | Antigen presentation/recognition | NM_001034668 | TGGTCCAGTTTAAGGGCCTG | GTCGAACCGCACGTACTCCT | Induced upon activation | Moser, B., Brandes, M. Gammadelta T cells: an alternative type of professional APC. Trends Immunol. (2006) 27: 112-118. | |
| TCR delta chain | Antigen presentation/recognition | D90419 | ACAACTCCAAAACCGATGGC | GACATCATGTTCACCTTCCCG | Induced upon activation | Geisler, C. TCR trafficking in resting and stimulated T cells. Crit. Rev. Immunol. (2004) 24: 67-86. | |
| TCR gamma chain | Antigen presentation/recognition | XM_600958 | GTCCTGGCTCCCGTCATG | GTGGCCCCTTGTGTAAGATCA | Induced upon activation | Geisler, C. TCR trafficking in resting and stimulated T cells. Crit. Rev. Immunol. (2004) 24: 67-86. | |
| Zeta-chain (TCR) associated protein kinase 70kDa (ZAP70) | Antigen presentation/recognition | XM_876478 | CAGCGTCTATGAGAGCCCCT | AGCCAAGTTCGATGTCAGCC | Induced upon activation | Budd, RC, Yeh, W-C, and Tschopp, J. cFLIP regulation of lymphocyte activation and development. Nature Reviews Immunology. (2006) 6:196-204. | |
| B cell lymphoma 10 (BCL-10) | Antiproliferative | BC118326 | CGCCTCCGCCATGGA | TTTCACACAGGTATACACGCAAATT | Induced upon activation | Budd, RC, Yeh, W-C, and Tschopp, J. cFLIP regulation of lymphocyte activation and development. Nature Reviews Immunology. (2006) 6:196-204. | |
| BAP37 (Prohibitin 2) | Antiproliferative | NM_001046198 | GGGCCTTCACTTCAGGATCC | GCAGGTCTTTGGAGCCTGTG | Repressed upon activation, higher in CD8+ gd T cells | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| Prohibitin | Antiproliferative | XM_881899 | GGCTCAGCAGGAAGCAGAGA | CTGCCTTCTTCTGCTGCTCA | gd T cell-specific (compared to ab T cells) - SAGE analysis | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| AP-1 | Cell cycle | XM_612669 | CGCGCTCGTCCCTCG | GTACCATTTCTGCAGCCGTAACT | Induced upon activation | Cipriani, B., Knowles, H., Chen, L., Battistini, L., Brosnan, C.F. Involvement of classical and novel protein kinase C isoforms in the response of Human Vg9Vd2 T cells to phosphate antigen. J. Immunol. (2002) 169: 5761-5770. | |
| E2F transcription factor 1 | Cell cycle | XM_615437 | GTGGTCGACTTGAACTGGGC | TTCTTCGCGATGAGGTGGAT | Repressed upon activation | Kirkham, P.A., Lam, E.W.F., Haru-Hisa, T., Parkhouse, R.M.E. Transcription factor E2F controls the reversible gd T cell growth arrest mediated through WC1. J. Immunol. (1998) 161:1630-1636. | |
| CD107a (lysosome-associated membrane protein-1) | Cell surface | XM_583968 | GAGAGCTCCAGCAGGGTGTT | GCCCTCAGTGAGCTGTTGGT | Induced upon activation | Deeta, C.O., Hebbeler, A.M., Propp, N.A., Cairo, C., Tikhonov, I., Pauza, C.D. Gamma interferon secretion by human Vg2Vd2 T cells after stimulation with antibody against the T-cell receptor plus the Toll-like receptor 2 agonist Pam3Cys. Infect. Immun. (2006) 74: 4505-4511. | |
| CD63 | Cell surface | NM_205803 | GGCCACCCCTAGTTTCCTGT | AGTTCTCCTTGCAGGCTCCA | Identified by SAGE | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| Growth factor regulated calcium channel | Cell surface | BC102512 | CCAAGGAGGGCAAAATCGA | CCCATAGGACCACTCGGTGA | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| ITM2B (integral membrane protein 2B ) | Cell surface | NM_001035093 | CGAGGAGGCGCTCATCATT | TGCACCAACACCAAGCTCTTC | Repressed upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| CCR5 | Cytokine receptor | NM_001011672 | TGCTCCACAATATGGCCTTG | CGAAGATGAGCCTCACAGCC | Induced upon activation | Chen, Z.W., Letvin, N.L. Adaptive immune response of Vg2Vd2 T cells: a new paradigm. TRENDS in Immunology. (2003) 24: 213-219. | |
| CCR7 | Cytokine receptor | NM_001024930 | CCCTTCTCGTCATTTTCCAGG | CACGGACTCGTACAGCGTGT | Induced upon activation | Brandes, M., Willimann, K., Moser, B. Professional antigen-presentation function by human gammadelta T cells. Science. (2005) 309:264-268. | |
| CXCR3 | Cytokine receptor | NM_001011673 | CTTTCTGCTGCACTTGGCTG | AGAGGCCAGAGCCAAAGACC | Induced upon activation | Chen, Z.W., Letvin, N.L. Adaptive immune response of Vg2Vd2 T cells: a new paradigm. TRENDS in Immunology. (2003) 24: 213-219. | |
| CXCR4 | Cytokine receptor | NM_174301 | TCCATGAAGGAACCCTGCTT | TTGCCCACTATGCCAGTCAG | Higher in CD8+ gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| Interleukin 12 receptor b1 (IL12R b1) | Cytokine receptor | XM_602621 | AAGTCCCCCAACGTTACCCT | TCCATACGCAGCTTCCCTG | Induced upon activation | Dagna, L., Iellem, A., Biswas, P., Resta, D., Tantardini, F., Fortis, C., Sabbadini, M.G., D'Ambrosio, D., Manfredi, A.A., Ferrarini, M. Skewing of cytotoxic activity and chemokine production, but not of chemokine receptor expression, in human type-1/-2 gd T lymphocytes. Eur. J. Immunol. (2002) 32:2934-2943. | |
| Interleukin 12 receptor b2 (IL12R b2) | Cytokine receptor | NM_174645 | AAGGTCTTCCCCTGGGCAC | AACAACCCCGACGGAGATCT | Induced upon activation | Dagna, L., Iellem, A., Biswas, P., Resta, D., Tantardini, F., Fortis, C., Sabbadini, M.G., D'Ambrosio, D., Manfredi, A.A., Ferrarini, M. Skewing of cytotoxic activity and chemokine production, but not of chemokine receptor expression, in human type-1/-2 gd T lymphocytes. Eur. J. Immunol. (2002) 32:2934-2943. | |
| Interleukin 15 receptor a (IL15Ra) | Cytokine receptor | XM_866719 | GCCATCCACAGCTCCTCCT | GGTATGTGTGTTCCGGAGCC | Induced upon activation | Chu, C.L. Chen, S.S., Wu, T.S., Kuo, S.C., Liao, N.S. Differential effects of IL-2 and IL15 on the death and survival of activated TCR gamma delta+ intestinal intraepithelial lymphocytes. J. Immunol. (1999) 162: 1896-1903. | |
| Nocturnin (CCR4 homolog) | Cytokine receptor | XM_612426 | GGAGATCCTCGCCTACCAGC | TGCCCTGATAGCCCAGTCTACT | Higher in CD8- gd T cells | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| G-CSF (colony stimulating factor 3 (granulocyte)) | Cytokines | AF092533 | CCAGAGCTTCCTGCTCAAGTG | GGTGGCACAGCTTGTGGG | Induced upon activation | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| GM-CSF | Cytokines | U22385 | ACGTGCCTGCAGACTCGC | TTCTCGTAGTGGGTGGCCAT | Induced upon activation | Yamashita, S., Tanaka, Y., Tsutsumi, S., Aburatani, H., Minato, N., Ihara, S. Analysis of mechanism for human gammadelta T cfell recognition of nonpeptide antigens. Biochem. Biophys. Res. Commun. (2005) 334: 349-360. | |
| Interferon beta | Cytokines | M15477 | CATCTTCGGCATTCTCACCA | GCAGACGATTCATCTGCCAAT | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Interferon gamma | Cytokines | M29867 | CCTGTCACCAAAATCTAACCTCAGA | CAGGCAGGAGGACCATTACGT | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Interleukin 10 (IL10) | Cytokines | NM_174088 | GAGCACCCTGTCTGACAGCA | GAAAGAAAGTCTTCGCCTCGC | Induced upon activation | Dagna, L., Iellem, A., Biswas, P., Resta, D., Tantardini, F., Fortis, C., Sabbadini, M.G., D'Ambrosio, D., Manfredi, A.A., Ferrarini, M. Skewing of cytotoxic activity and chemokine production, but not of chemokine receptor expression, in human type-1/-2 gd T lymphocytes. Eur. J. Immunol. (2002) 32:2934-2943. | |
| Interleukin 13 (IL13) | Cytokines | NM_174089 | CCTATGCGTCTGCTCCTCAAT | GCCATGGAGCCTAGAACAGC | Induced upon activation | Yamashita, S., Tanaka, Y., Tsutsumi, S., Aburatani, H., Minato, N., Ihara, S. Analysis of mechanism for human gammadelta T cfell recognition of nonpeptide antigens. Biochem. Biophys. Res. Commun. (2005) 334: 349-360. | |
| Interleukin 17 (IL17) | Cytokines | NM_001008412 | GGCAGGAGTCATCATCCCAC | TGCTCCGGTTAACGATGTTT | Induced upon activation | Lockhart, E., Green, A.M., Flynn, J.L. IL-17 production is dominated by gammadelta T cells rather than CD4 T cells during Mycobacterium tuberculosis infefction. J. Immunol. (2006) 177: 4662-4669. | |
| Interleukin 1b (IL1b) | Cytokines | NM_174093 | AACACCTGGACCTCGGTTCC | CACGATGACCGACACCACC | Induced upon activation | Wesch, D., Beetz, S., Oberg, H.H., Marget, M., Krengel, K., Kabelitz, D. Direct Costimulatory effect of TLR3 ligand Poly(I:C) on human gd T lymphocytes. J. Immunol. (2006) 176: 1348-1354. | |
| Interleukin 4 (IL4) | Cytokines | NM_173921 | TGCCCCAAAGAACACAACTG | CGCCCAGGAATTTGTTCAAG | Induced upon activation | Dagna, L., Iellem, A., Biswas, P., Resta, D., Tantardini, F., Fortis, C., Sabbadini, M.G., D'Ambrosio, D., Manfredi, A.A., Ferrarini, M. Skewing of cytotoxic activity and chemokine production, but not of chemokine receptor expression, in human type-1/-2 gd T lymphocytes. Eur. J. Immunol. (2002) 32:2934-2943. | |
| Interleukin 5 (IL5) | Cytokines | NM_173922 | GACTGGTGGCAGAGACCTTGA | TCAGCAGAGTTCGATGAGAGGAG | Induced upon activation | Yamashita, S., Tanaka, Y., Tsutsumi, S., Aburatani, H., Minato, N., Ihara, S. Analysis of mechanism for human gammadelta T cfell recognition of nonpeptide antigens. Biochem. Biophys. Res. Commun. (2005) 334: 349-360. | |
| Interleukin 6 (IL6) | Cytokines | BC123577 | CAGTTCAGCCTGAGAGCTATTCG | GCCCAGTGGACAGGTTTCTG | Induced upon activation | Wesch, D., Beetz, S., Oberg, H.H., Marget, M., Krengel, K., Kabelitz, D. Direct Costimulatory effect of TLR3 ligand Poly(I:C) on human gd T lymphocytes. J. Immunol. (2006) 176: 1348-1354. | |
| Interleukin 8 (IL8) | Cytokines | NM_173925 | ACTTCCAAGCTGGCTGTTGC | TGGCATCGAAGTTCTGTACTCATT | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Lymphotactin (XCL1) (small inducible cytokine subfamily C, member 1) | Cytokines | NM_175716 | GCTTCTCATCCTGACCTGCC | TCAGACTCACACAGATGCTCTTTTC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| MCP1 (monocyte chemotactic protein 1) (CCL2) | Cytokines | NM_174006 | AACATGAAGGTCTCCGCTGC | GCGACTTGGGAGTTAATTGCAT | Induced upon activation | Wesch, D., Beetz, S., Oberg, H.H., Marget, M., Krengel, K., Kabelitz, D. Direct Costimulatory effect of TLR3 ligand Poly(I:C) on human gd T lymphocytes. J. Immunol. (2006) 176: 1348-1354. | |
| MIP-1a | Cytokines | XM_871420 | ACCAGCAGCCAGTGCTCC | GGTGATGTATTCCTGGACCCA | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| MIP-1b | Cytokines | NM_001075147 | CACCAATGGGCTCAGACCC | GAGGCTGCTGGTCTCGAAGT | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| RANTES (CCL5) | Cytokines | NM_175827 | GCACCCACGTCCAGGAGTAT | CTCTGGGTTGGCGCACA | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TARC (thymus and activation-regulated chemokine) (CCL17) | Cytokines | XM_869852 | ACCAGACCTCGGACGATTGT | TGCCTTCTTCACCGTTTTGTC | Induced upon activation | Dagna, L., Iellem, A., Biswas, P., Resta, D., Tantardini, F., Fortis, C., Sabbadini, M.G., D'Ambrosio, D., Manfredi, A.A., Ferrarini, M. Skewing of cytotoxic activity and chemokine production, but not of chemokine receptor expression, in human type-1/-2 gd T lymphocytes. Eur. J. Immunol. (2002) 32:2934-2943. | |
| TGF beta | Cytokines | M36271 | GGAGTGGCTGTCCTTTGACG | TGTCACAGGAACAGTGGGCA | Expressed by WC1.1 and WC1.2 gd T cells | Rogers, A.N., VanBuren, D.G., Hedblom, E.E., Tilahun, M.E., Telfer, J.C., Baldwin, C.L. Function of ruminant gammadelta T cells is defined by WC1.1 or WC1.2 idoform expression. J. Immunol. (2005) 108: 211-217. | |
| TNF alpha | Cytokines | NM_173966 | CCAGAGGGAAGAGCAGTCCC | GGGCTACCGGCTTGTTACTTG | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TNF beta (LTA lymphotoxin alpha) | Cytokines | NM_001013401 | GGACCGCGCCTTCCTC | CGGAGAAGACCACTTGGGAG | Induced upon activation | Lafont, A., Loisel, S., Liautard, J., Dudal, S., Sable-teychene, M., Liautard, JP., Favero, J. Specific signaling pathways triggered by IL-2 in human Vg9Vd2 T cells: An amalgamation of NK and ab T cell signaling. J. Immunol. (2003) 171:5225-5232. | |
| VEGF | Cytokines | NM_174216 | GGATGTCTACCAGCGCAGCT | CACAGGACGGCTTGAAAATGA | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Lymphocyte cytosolic protein 1 (L-plastin) | Cytoskeleton | NM_001034720 | CCACGTGGTTAATATCGGCG | TGTCGGCAAATAACCCAATCTT | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Microtubule-associated protein 4 isoform 1 | Cytoskeleton | AB079579 | CTACCGGAAGCGTGTCTGGA | AGGTTGAGTGGTGGCCAAAG | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Moesin | Cytoskeleton | NM_001046477 | GACAAAAAAGCCCCGGACTT | CGGCGCATGTATAGCTCATG | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Thymosin-beta 4 | Cytoskeleton | AY192438 | TGCTACCCCTTTTCACATCAAA | AGTTCTTTTCCTTCCCTGCCA | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Vimentin | Cytoskeleton | NM_173969 | GACGCCATCAACACCGAGTT | AAGCGCACCTTGTCGATGTAG | Higher in CD8- gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| CD11b (integrin alpha M (ITGAM)) | Innate Receptors | NM_001039957 | CTCTTGCATTTGCTGCCAAC | CGAGAAGCAGAGGCCATTTG | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| CD14 | Innate Receptors | NM_174008 | TGAACATTGCCCAAGCACAC | GCCGAGACTGGGATTGTCAG | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| CD16 | Innate Receptors | BC112756 | CTCATCTCAAGCCAGACCCC | GGGTCACTGGGTGCAGAGAG | Induced upon activation | Lafont, V, Liautard, J, Liautard, JP, Favero, J. Prodiction of TNFa by human Vg9Vd2 T cells via engagement of FcgammaRIIIA, the low affininty type 3 receptor for the Fc protion of IgG, expressed upon TCR activation by nonpeptidic antigen. J. Immunol. (2001) 166:7190. | |
| CD36 | Innate Receptors | NM_174010 | CCCTGAGACCCACACGGTC | GGTTGAGAATGGTGAACGTGTC | Induced upon activation | Lubick, K., Jutila, M.A. LTA recognition by bovine gammadelta T cells involves CD36. J. Leukoc. Biol. (2006) 79: 1268-1270. | |
| CD38 | Innate Receptors | NM_175798 | CGACACCTACACCCAGACGA | TGCAGGGATCCTTGGAAATG | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| DECTIN-1 (dendritic cell-associated C-type lectin 1) | Innate Receptors | NM_001031852 | GGCTTTGTGCTGCATCCTCT | ACCCGAGGTACTCAGGACCA | Induced upon activation | M.A. Jutila, unpublished observation | |
| MARCKS (80-87 kd myristoylated alanine-rich C kinase substrate) | Innate Receptors | M24638 | CGAAGGCTGAGGACGGG | GCCGCTCAGCTTGAAAGACTT | Induced upon activation | M.A. Jutila, unpublished observation | |
| MARCO | Innate Receptors | XM_864315 | TCAGTCCGGATTATCGGCTC | GCATCTGAACCATCCCAGCT | Repressed upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| MBL (MBL-A) | Innate Receptors | NM_001010994 | TCGGTTGCTGAGGCTAAGCT | TTGCCCAAGGAGAAGGTTTG | Repressed upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| MBL2 (mannose-binding lectin 2) | Innate Receptors | NM_174107 | CAAAACTGGAATGATGGCGA | GAGGCGGAACAAGCGATGT | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| MyD88 | Innate Receptors | NM_001014382 | GCCTTCATCTGCTACTGCCC | CGGTCAGACACGCACAACTT | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| NALP1 | Innate Receptors | XM_606578 | CCAAGGGACCACACGTGAAC | ACTTGGCGAGTGGGAGAATG | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| NKG2D | Innate Receptors | NM_001075139 | TGGTTCCTGGCAATGGGA | GCCATAGACTGCACAGGTTCC | Induced upon activation | Pennington, D.J., Silva-Santos, B., Shires, J., Theodoridis, E., Pollitt, C., Wise, E.L., Tigelaar, R.E., Owen, M.J., Hayday, A.C. The inter-relatedness and interdependence of mouse T cell receptor gd+ and ab+ cells. Nat. Immunol. (2003) 4: 991-998. | |
| NKR-P1A (natural killer cell receptor protein 1 (KLRB1)) | Innate Receptors | XM_612914 | CACATCAGTAGAAAAAACCAGCATG | CCAGTGCATTGGACACGTTAAC | Induced upon activation | Poggi, A., Zocchi, M.R., Costa, P., Ferrero, E., Borsellino, G., Placido, R., Galgani, S., Salvetti, M., Gasperini, C., Ristori, G., Brosnan, C.F., Battistini, L. IL-12-mediated NKRP1A up-regulation and consequent enhancement of endothelial transmigration of V delta 2+ TCR gamma delta+ T lymphocytes from healthy donors and multiple sclerosis patients. J. Immunol. (1999) 162: 4349-4354. | |
| NOD1 (Caspase recruitment domain 4) | Innate Receptors | XM_598513 | TGGTACAGAGCAAGGGCGAG | AATCTCCGACAGCCAAGGC | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| NOD2 (CARD15) | Innate Receptors | NM_001002889 | GACCTGCAGAGTCACCGACC | TCGTACTGGCTGATGAAACCC | Induced upon activation | J.F. Hedges. Unpublished observations. | |
| PKR (PRKR) | Innate Receptors | NM_178109 | CTTTTCGCCTCCTCCTCATG | AACGAATACAGGCTCGCAGAA | Induced upon activation | Hedges, J.F., Buckner, D.L., Rask, K.M., Kerns, H.M.M., Jackiw, L.O., Trunkle, T.C., Pascual, D.W., Jutila, M.A. Early response of mucosal derived ab and gd T cells to experimental Salmonella enterica serovar Typhimurium erterocolitis: Innate priming of gd T cells. (2006) Submitted for publication. | |
| SARM | Innate Receptors | XM_616381 | CCCAACCTCTTCGTCCAAGA | GACGATACAGGAGGGAGGGTG | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Scavenger receptor AI/II (SRA I and II) | Innate Receptors | NM_174113 | TATGGCACAGTGGGATGACTTTC | GAGGAAGCAAAGCTGTCACTGAG | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Scavenger receptor B1 (SRBI) | Innate Receptors | NM_174597 | ATCGTGATGGTGCCCTCAAT | GGGACAGGGATTTCCTTCCA | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TLR1 | Innate Receptors | NM_001046504 | CAAGGGAACCCCTCTAAAGGA | CAACAGCCAGCACCAGCC | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TLR2 | Innate Receptors | NM_174197 | GCTTTGTGGACAGCATGGGT | TCGCAGACACCAGTTGGGT | Induced upon activation | Hedges, J.F., Buckner, D.L., Rask, K.M., Kerns, H.M.M., Jackiw, L.O., Trunkle, T.C., Pascual, D.W., Jutila, M.A. Early response of mucosal derived ab and gd T cells to experimental Salmonella enterica serovar Typhimurium erterocolitis: Innate priming of gd T cells. (2006) Submitted for publication. | |
| TLR3 | Innate Receptors | NM_001008664 | GAGCCCCAGTCTCACAGAGAA | TCGTGTGGCTGATTGTGTCC | Induced upon activation | Wesch, D., Beetz, S., Oberg, H.H., Marget, M., Krengel, K., Kabelitz, D. Direct Costimulatory effect of TLR3 ligand Poly(I:C) on human gd T lymphocytes. J. Immunol. (2006) 176: 1348-1354. | |
| TLR4 | Innate Receptors | NM_174198 | ACCTGATGCTTCTTGCTGGC | ATTCCGCACCCAGTCTTCAT | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TLR6 | Innate Receptors | NM_001001159 | CAAGGGAACCCCTCTAAAGGA | CAACAGCCAGCACCAGCC | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TLR7 | Innate Receptors | NM_001033761 | CCCTCACCATTAACCACATAGCA | TCGAACAGGTACGCAGTTGC | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TLR8 | Innate Receptors | XM_610774 | CCCTCTTGCTTTTCAAACCCT | GATTGTGCATGTTGTCAAACCAG | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TLR9 | Innate Receptors | NM_183081 | CAAGGGAACCCCTCTAAAGGA | CAACAGCCAGCACCAGCC | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TRAM | Innate Receptors | NM_001040476 | CCATGGCGATTCGCAAG | GACCATCGCCACACAGGAG | Identified by microarray and/or qRT-PCR | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| WC1.1 (CD163 molecule-like 1) | Innate Receptors | NM_176651 | ACACTTGCCACTGCCCAGAT | CAGACCTGGGCACTGGACTC | Induced upon activation | Rogers, A.N., VanBuren, D.G., Hedblom, E.E., Tilahun, M.E., Telfer, J.C., Baldwin, C.L. Gammadelta T cell function varies with the expressed WC1 coreceptor. J. Immunol. (2005) 174: 3386-3393. | |
| WC1.2 | Innate Receptors | DQ154040 | GTGAGGTCCTCTCAGACAGGCT | CCTTTCTTCCCCTGGAGCAG | Induced upon activation | Rogers, A.N., VanBuren, D.G., Hedblom, E.E., Tilahun, M.E., Telfer, J.C., Baldwin, C.L. Gammadelta T cell function varies with the expressed WC1 coreceptor. J. Immunol. (2005) 174: 3386-3393. | |
| GBP-1 (Interferon-induced guanylate-binding protein 1) | Interferon response | XM_590008 | TTGTGGTGGTGGCTATCGTG | CACTGTGGAGCCCAGAGAGAA | Higher in CD8+ gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| IRF1 | Interferon response | NM_177432 | AAGTCCAGCCGAGACGCTAG | TCAGGCAGGGTGGAGCTACT | Higher in CD8+ gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| IRF2 | Interferon response | XM_592435 | TCTGGACGGCACCTATGAGG | TGCTGACCGGCTGTTCATC | Higher in CD8+ gd T cells | Hedges, J.F., Cockrell, D., Jackiw, L., Meissner, N., Jutila, M.A. Differential mRNA expression in circulating gd T lymphocyte subsets defines unique tissue-specific functions. J. Leukoc. Biol. (2003) 73: 306-314. | |
| Jak1 | Interferon response | XM_617357 | CTTGTCCTTCGTGTCCCTGG | TGTTGTGGACGATCAATGGG | Induced upon activation | Lafont, A., Loisel, S., Liautard, J., Dudal, S., Sable-teychene, M., Liautard, JP., Favero, J. Specific signaling pathways triggered by IL-2 in human Vg9Vd2 T cells: An amalgamation of NK and ab T cell signaling. J. Immunol. (2003) 171:5225-5232. | |
| Jak2 | Interferon response | XM_865133 | GCTCAGTGGCGGCATGA | CTAACACTGCCATCCCAAGACA | Induced upon activation | Lafont, A., Loisel, S., Liautard, J., Dudal, S., Sable-teychene, M., Liautard, JP., Favero, J. Specific signaling pathways triggered by IL-2 in human Vg9Vd2 T cells: An amalgamation of NK and ab T cell signaling. J. Immunol. (2003) 171:5225-5232. | |
| Phosphatidylinositol transfer protein, membrane-associated | Lipid metabolism | XM_613401 | AGGAGGAGTTCTTTGATGCCC | AAAGGCGTCGATGAAGTCGT | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Phospholipase C gamma 1 (PLCgamma1) | Lipid metabolism | NM_174425 | GCGAGAGATTGAGGAGCCTTAC | GGCACACCTCGTCTAGCTGC | Induced upon activation | Budd, RC, Yeh, W-C, and Tschopp, J. cFLIP regulation of lymphocyte activation and development. Nature Reviews Immunology. (2006) 6:196-204. | |
| Acylphosphatase | Metabolism | NM_001045982 | AGCTTGGATTAGTAGGCTGGGTC | AAGCCATTCCTGCATATGACG | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Dihydrolipoamide branched chain transacylase E2 (DBT) | Metabolism | NM_173905 | GGGCCCTGGGAACAATTAAG | AATTCTGTGATCAGCCGACCA | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Dopamine beta-hydroxylase (DBH) | Metabolism | NM_180995 | TTGGTGGTGCTCTGGACTGAC | AGCTGGTAATCCTGCTGGGA | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Isocitrate dehydrogenase 3 (NAD+) alpha (IDH3A) | Metabolism | NM_174644 | AATCGAGCATGTGATCGTGG | TCCGTGCGTATTCAAATGCA | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| NADH-ubiquinone oxidoreductase chain 6 | Metabolism | TC276903 | GGCTCCTGATTCTCGAAGGA | TGGGCTTCCAAAGCTCTCA | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Succinate dehydrogenase complex subunit A (SDHA) | Metabolism | DQ402990 | CCTCTGTGGTGGAGCTGGAG | CCCGAACTTGAGGCTCTGTC | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Beclin | Misc. (Anti-viral) | NM_001033627 | ATGCAGGTGAGCTTCGTGTG | GGAGCTGTGAGCTCCTGGAT | Repressed upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| Xanthine dehydrogenase (XDH) | Misc. (Electron transport) | NM_173972 | AACTGGGCAAGGACTCGAAA | GAGCTGGATGTTGGCTGGAG | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Connexin 43 | Misc. (Gap junction) | NM_174068 | GTTCAAGCCTACTCCACGGC | TCACCCCAGGCTGACTCAAC | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Keratinocyte growth factor (KGF) | Misc. (Growth factor) | XM_869016 | TACCTGCACACCTTGCCAAC | CTGTGTTCTGGCCACAGGG | Induced upon activation | Born, W.K., O’Brien, R.L. The healing touch of epidermal T cells. Nat. Med. (2002) 8: 560-561. | |
| CD94 | Misc. (Inhibits NK cell function) | NM_001002890 | GAACAAGCATCCACAGTGCCT | CCTAAGACCCCAGAGATCAACCT | Induced upon activation | M.A. Jutila, unpublished observation | |
| Seryl-tRNA synthetase (SARS) | Misc. (Protein biosynthesis) | NM_174175 | ACAGACTATCAGGCTCGCCG | GCACACATGGTGGCATTGAG | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| NAD(P)-dependent steroid dehydrogenase | Misc. (Steroid biosynthesis) | XM_600924 | GACCGAGTTCATCCAGGCTG | CAGACATTCCGTAGGAGGCC | gd T cell-specific (compared to ab T cells) - SAGE analysis | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Ta1 (solute carrier family 7 member 5 (SLC7A5)) | Misc. (Transport) | NM_174613 | GGGTGACGTAGCCAATCTGG | CATAGGCAAAGAGGCCGCT | Induced upon activation | Quinn, M.T., Swain, S.D., Parkos, C.A., Jutila, K.L., Siemsen, D.W., Kurk, S.L., Jesaitis, A.J., Jutila, M.A. A carbohydrate neoepitope that is up-regulated on human mononuclear leukocytes by neuraminidase treatment or by cellular activation. Immunology. (2001) 104:185-197. | |
| Blimp-1 | Myeloid-related | XM_618588 | AAAGGGAAGGACTTGTACCGC | GGGTAGAAGGGCATCTCCG | Induced upon activation, higher in CD8- gd T cells | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| CD83 (B-cell activation protein) | Myeloid-related | XM_869209 | CCCCAGGGAAAGGCTGTACT | GGTTTCTCTGCCCTTCCTGAC | Induced upon activation | Brandes, M., Willimann, K., Moser, B. Professional antigen-presentation function by human gammadelta T cells. Science. (2005) 309:264-268. | |
| DEC-205/CD205 | Myeloid-related | NM_001001158 | TGGATAGTGGTAAAGGACTGCGA | AGGCCAAGACACTTCTGGGA | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| HSPCB (heat shock 90kDa protein 1 beta) | Myeloid-related | BT025368 | CATCGTGACCAGCACCTACG | TTTTGGCCATCATGTAGCCC | Induced upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| Immunoglobulin heavy chain binding protein (BiP) | Myeloid-related | XM_585062 | CATCGACCTGGGTACCACCT | CATAAGACGGCGTGATGCG | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Immunoglobulin heavy chain V region | Myeloid-related | XM_593518 | TCAGTGAGCAGCGTGACACC | CTTGATGCAGGAACCAGCAG | gd T cell-specific (compared to ab T cells) - SAGE analysis | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Immunoglobulin heavy chain variable region | Myeloid-related | XM_583349 | TGGTGTAGTCTGGGTCCGC | GGGATTTCAGGGCTGGGTTA | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| NRAMP (SLC11A1) | Myeloid-related | NM_174652 | TCTGGCTGACCATCGAGCTA | GAGTGGGATTCGTCCGGC | Induced upon activation | M.A. Jutila, unpublished observation | |
| Triggering receptor expressed on myeloid cells 1 precursor (TREM-1) | Myeloid-related | AY525122 | GGTCCAGACACTGGCAATCA | CCATTTGGATTTGCAGCATG | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| Caspase 7 | Proapoptotic | XM_604643 | GTTCATGCAATGCGTCGATG | TGCTCCACAATATGGCCTTG | Repressed upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| Fas receptor | Proapoptotic | U34794 | TCCTGCCAAGAAGGCCTGTA | GGTGTATCTCCGTCGCGTTT | Repressed upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| FasL | Proapoptotic | XM_584322 | TCATGGTTCTGGTGGCCCT | CCTTTGGCTGGTGGACTCTCT | Induced upon activation | Dagna, L., Iellem, A., Biswas, P., Resta, D., Tantardini, F., Fortis, C., Sabbadini, M.G., D'Ambrosio, D., Manfredi, A.A., Ferrarini, M. Skewing of cytotoxic activity and chemokine production, but not of chemokine receptor expression, in human type-1/-2 gd T lymphocytes. Eur. J. Immunol. (2002) 32:2934-2943. | |
| Galectin-1 | Proapoptotic | NM_175782 | TCATGGCTTGTGGTCTGGTC | CAGCAAGAAGCTCTTGGCGT | Induced upon activation, higher in CD8- gd T cells | Meissner, N., Radke, J., Hedges, J.F., White, M., Behnke, M., Bertolino, S., Abrahamsen, M., Jutila, M.A. Serial analysis of gene expression in circulating gd T cell subsets defines distinct immunoregulatory phenotypes and unexpected gene expression profiles. J. Immunol. (2003) 170: 356-364. | |
| Growth arrest and DNA-damamge-inducible beta (GADD45B) | Proapoptotic | NM_001040604 | GGACCTGCACTGTCTCCTGG | TGTTCCCCCTACTTTCTTCGC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Nuclear receptor subfamily 4, group A, member 2 (nur77 beta-type) | Proapoptotic | NM_001076208 | CGCAGGAATCGCTGTCAGTA | CGACCTCTCCGGCCTTTTA | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| PDCD4 (programmed cell death 4) | Proapoptotic | XM_583210 | AGGTGGAAAGCGCAAAGACA | TTTCAGCAGCATATCAATCTCTTTAAC | Repressed upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| PDCD6IP (programmed cell death 6 interacting protein) | Proapoptotic | XM_612802 | GCTCCTTCAATCCCAACACC | GGCTTAGTAGGCGGCATGG | Repressed upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| Pleckstrin homology-like domain, family A, member 1 | Proapoptotic | XM_591758 | GCGCAAGGGCAAGTACATGT | ACGTGATCTCGGCGTTCC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TGFB inducible early growth response (TIEG) | Proapoptotic | XM_868832 | ATCCGTTCACAAAGTTGCACG | CCTGTCTGCAAAGTCCTCCC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| Thymosin-beta 10 | Proapoptotic | NM_174623 | GCCGACCAAAGAGACCATTG | TCACGGCTAGGGTCTCCAAG | Repressed upon activation | Deng, M., Liu, J., Pelak, C.N., Lancto, C.A., Abrahamsen, M.S. Regulation of apoptotic pathways in bovine gamma/delta T cells. Vet. Immunol. Immunopathol. (2005) 105: 15-23. | |
| TNF (ligand) superfamily, member 14 (TNFSF14) | Proapoptotic | XM_864121 | CACTGGCGCCTAGAGGAGAT | GCTGGTTTGTCTTGCTTGGG | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| TNFR superfamily, member 9 (TNFRSF9) | Proapoptotic | NM_001035336 | CCTGGGAGAGAGCCAGGTCT | AAACGGAGAACCAGGAAGGAC | Induced upon activation | Hedges, J.F., Lubick, K.J., Jutila, M.A. Gamma delta T cells respond directly to pathogen-associated molecular patterns. J. Immunol. (2005) 174: 6045-6053. | |
| BCL-6 | Proliferation | XM_865691 | GCTGTATCCAGTTCACCCGC | CCGGCTCACCACTATGACAAC | Induced upon activation | Martins, G.A., Cimmino, L., Shapiro-Shelef, M., Szabolcs, M., Herron, A., Magnusdottir, E., Calame, K. Transcriptional repressor Blimp-1 regulates T cell homeostasis and function. Nat. Immunol. (2006) 7: 457-465. | |
| CD30 (Lymphocyte activation antigen) | Proliferation | XM_866401 | ACGTGTTCAGGAGATGGCCT | GTGACTGGTGTGGCGCAG | Induced upon activation | Dagna, L., Iellem, A., Biswas, P., Resta, D., Tantardini, F., Fortis, C., Sabbadini, M.G., D'Ambrosio, D., Manfredi, A.A., Ferrarini, M. Skewing of cytotoxic activity and chemokine production, but not of chemokine receptor expression, in human type-1/-2 gd T lymphocytes. Eur. J. Immunol. (2002) 32:2934-2943. | |
| Cell division cycle 10 (CDC10) | Proliferation | NM_001001168 | GGATGTCGGTCAGTGCGAG | AAATCCCACATAGCCTTCAAGGT | Repressed upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| JunB | Proliferation | NM_001075656 | ACGACGACTCATACGCAGCA | TGACAGGTTGAGCGCCAG | Induced upon activation | Graff, J.C., Behnke, M., Radke, J., White, M., Jutila, M.A. A comprehensive SAGE database for the analusis of gammadelta T cells. Int. Immunol. (2006) 18: 613-626. | |
| ADAM10 (a disintegrin and metalloproteinase domain 10) | Protease | ||||||